Orbiting the Sun

by Janet Kaplan


 

night’s bauble, night’s pixel
changes form

 

 

 

 

 

 

 

 

 

 

Inner Sphere

 

Who are born ice

air melting them like thoughts
leaking space
and leaky time

The older boys shove you and the boy you like between the vestibule door and wall. Bronx side-street, late afternoon. They make you kiss, say they’ll pull your shorts down if you don’t. I have asthma, says your little boy, red-faced and wheezing. Later, upstairs: shame’s home and invisibility. Its inner sphere.

Light—
it licks
the bright yolk
the mind
the drip

The living and working rooms must be well ventilated. A window in the bedroom should be opened a foot both at the top and bottom in winter, twice as much when the weather is not cold. Good food Business solutions About our ads Exercise, especially such as calls into action the chest muscles and fills the lungs with air Some results have been removed Richmond Air Show “Watch, now he’s getting ready!” There he goes! Gee whiz! Wasn’t that swell?”

 

 

 

 

 

 

 

Hello, World

 

Orchard Beach and blanket throngs. Wandering off meant trailing wet sand-edges, shoreline’s glare and shriek. Kids, gulls. Beyond the jetties, rocky pools. Stand of trees. Heading back, you lose them—sleeping mother and the father. Transistor’s ballgame voice, red-black thermos of gin.

A softness undone, harsher than fear: they’re drunk, never noticed you were gone—belying your lost-ness. But here they are, sunlight’s knives. Their acceptance of your nothingness.

 

 

with Ada.Text_IO; use Ada.Text_IO;
procedure Hello is
begin
Put_Line (“Hello, world!”);
end Hello;

 

 

 

 

 

 

 

Distant Points

 

Skimmed from the creamy thing we thought was needed: permanence. Home. The word listens and tries Restore. It can’t be grasped—it’s leaking. The victim of forward motion. The lie of it.

 

At distant points the foreign traveler has necessarily to fear, that the impressions made upon him, by local and provincial feelings and prejudices, may usurp, in his mind that place—which should be given only to such as are universal Value and property records home value and

 

And were the Best of Us—those whose Actions matter’d Most—to Drown in a Crowded Sea? Were we not Fishermen in God’s Expansive Rooms, in this our Deserv’d Circumstance? In this New-Found Our-Land, Our God’s Worldwide is listening in

 

 

 

 

 

 

 

Regular Orbit

 

Not a pleasant sound. Barefoot? Incredulous. Barefoot? (You were a child, playing contentedly on the sidewalk.) Drunk.             Put       yer       shoos       ahn. March. Before I—.

 

 

Now exit the site, not seeing what happened when you went back inside.

 

 

 

 

 

 

 

Lamplight

 

These Bundists, they like arguing. Grandfather—regular babysitter—had no patience for Bundists, less for Americans. Women, girls, educated men. Pah! Feh! Old men in workshirts, coarse trousers, suspenders. Thug caps and fedoras stayed on their heads. They frightened you but you were among them. Weak coffee, mushroom barley, used napkins, two-cents plain. Warm potato smell, Concourse lamplight through plate glass, clatter of coffee-stained cups up from the washers’ steam. Un-lonely saucers and cups.

 

 

 

 

 

 

 

Time Survey

 

Wikiquick                                      time juiced                  and sticky
with transgress—                               undressing

fluidity of clever siliconian bowels                     unpeeling like a latchkey kid
      him touching you there—                     speedshock

Didn’t expect anyone home until dark    warm bit of yourself—
and his tongue draws blood

Some servers serving tiny specks of glottogony                            covers blown back
of time too complex               language a lifestew monster

made of a thief’s thieved parts                leaking protean nucleic acids                              
ordure in caves                                   unbreakable                ore of

tools in proto-human hands                     <lookinside!>             cavernous hunger
ceci n’est pas une vache

Easily domesticated         caloric meat                clustered by rivers
biblically bitumenical                                                carbs

cooling      the counting system              (blocks of twelve)      wheels’
iron empires     scrawled-on treetrunk (codex)                     silk-plagued road

gunpowder-compassed                 and amaizeing               conquistadorial spillage
ninetyfivepercent decimation rate                 of sugar slaves

sugary coal up from ancient ferns                       pump powered                  combustible
engines            exploiting       the slosh

. . .

ing code                           of now’s molecular                            interna
tional warring fare                              strophe            strife               matter’s

unloved bits                            earthlife a liquid
crystal display                       earth                a preverbal child’s

long memory
search “source”: About 3,250,000,000 results (0.34 seconds)

 

search “touch”:

 

 

 

 

 

 

 

Tight Orbit A

 

Lucens, Queen,
wrote the feeble little monk,
Precor hoc cape cara Volumen

as if to say Take this precious book
in which I write your blazing story
in the burning century that weds you
to humpback and stepbrother,
torch-lights the cells,
the day’s walled rule

Un-queasy Artist,
scale your length of world
—defeat worlds, install worlds—
and I, bit player,
confessor,-chronicler
will write it

as if to say
Take me; the sight of you doth eclipse my sight

 

Your cunt tastes better than whiskey, your lover once said

Then better with whiskey

 

Then the whiskey had him

 

 

 

 

 

 

Tight Orbit B

 

Exclamation breaking onto the screen,
Onto the brilliant screen—a jackhammer!

Oh, the autumn foliage
Of the hill of Kamioka!

.           .           .

The sleeves of my coarse-cloth robe
Are never for a moment dry.

 

Then the back and forth with yourself:
Interview on a gravel hill

.           .           .

No, they said. No college.
Who’ll marry you if you go?

electronselectric current
a method to stun (erase) farm animals

a treatment that sometimes cures
(erases)

Years later you said to your child: If you go,
who the hell will look after me?

 

 

 

 

 

 

Inner Orbit

 

devils = mailer daemons? A Scandinavian classic that’s perfect for elevenses or teatime Outerwear Military Green $407 Why did I get this ad of the human race in whom the Devil wholly taking up residence Parents finally dead, your younger brother keeps the house. Returns to it after work each evening as he’s always done. Bolt-locks himself into his own small room as he’s always done.

 

 

 

 

 

 

Nostalgia
(returns home + survives)

 

…these verses… weren’t written in my garden…
or while you, my familiar couch, supported me
. . .
this garden has hardness
this couch, no color
this verse doesn’t depend upon
your being in this room, the water
. . .
I’m tossed on the stormy deep…
and the paper itself exposed to the dark waters
. . .
and the going-backwards machine
finds expression in its salty language:
I’ll give you everything-nothing
. . .
Let the storm defeat the man!
Yet at the same time
let him halt the music of his songs
as I do mine
as the machine sings
of-self not-self!

 

You return, drunk at the screen, naked on the couch.
Swarming the window, flies want to get in, then out.

Passed out, you drop the screen.
Home—.

 

There, there. There, there

 

 

 

 

 

 

 

Orbiting the Sun
(With Photodecomposition of Plastic)

 

 

Light plays across the plays. Explosive plasma, light quanta to molten core. Even at the ocean floor, light exists. Seafloor to abyssal, midnight to twilight. Sunlight to garbage-island suspension. Your home to someone else’s. I-thou becoming Them. Neustonic layer (earth’s babyfood) to polymer vortex (a native formula goes eternal)

 

Home, light’s platform, thinning out

Sunlight looks back motherly,
lover of glut and reduction, indiscriminate touch

but the hapless man touched nothing but yielding air
yielding home

 

 

 

 

 

 

 

Outer Orbit

 

But who could glean a seething brain—                seedling pain’d
cracked the earthenware              dirt        (yours and mine           yours v. mine)
spilling haplessly  the unripen’d grain                  as once from an open window
you watched a speeding van—                off in a cloud of symbols and their time

Thereby silicic

and disinterred

you scrolled               root, element, meme—                            True,
we’d inferred              before leaving, each as other:                       we want to be
and simply for that, loved.                             Absent thine:
language, load

proffering / suffering

distant code

time bits from the world wide woe    phonemically clicked             uniting rages
along mistaken unities                       documenting temporarily                  the mania for
infinite thought—              wide world alone                     in loneliness caught

 

 

 

 

 

 

 

Flight Path

 

Moving van—you here? Did they keep her child? Were their swaddled bundles taken to the cart? Planes along the new flight path. Screenlight. Do they wake you? Did they wash a thousand birds? For how long did they lament? Do you want to save this? Does space (bitten place) want its bite back? Whole again. Without us again.

 

 

 

 

 

 

 

 

Code Sequence
(A Selfie)

 

 

Quarkish. On-offish. ATCAATTAAAATTTTATGTGAish. Hello-goodbye-ish. Code-switchily in thrall to little protein bits like Big Bang’s in thrall to like a black hole’s in thrall to my birthplace seen from their distance slush slosh now waterways grasslands now pasture now wood and cloth sails a haarlem river now steamships traffic to a stadium spilling onto the overhead pass now code mad with travel sending stop-go symbols alluring wet-for-hard-for an epidemic transmitting-detecting home-none gone-here 01001001 00100000 01000001 01101101 00100000 01010100 01101000 01100001 01110100

 

 

 

 

 

 

 

 

Source notes for Orbiting the Sun

“Inner Sphere”: Alvin Davidson, The Human Body and Health, Revised. American Book Company, 1909; and Woolner Calisch, “Richmond Air Show of 1909,” Richmond-Times Dispatch, 1939.

“Hello, World”: Ada Language, developed by Jean Ichbiah for the U.S. Department of Defense.

“Distant Points”: Edward Augustus Kendall, Esq., Travels Through the Northern Parts of the United States, The Years 1807 and 1808. New York, 1809.

“Tight Orbit B”: lines from “After the death of the Emperor Tenmu,” a waka, ca. 703, attributed to Empress Jitō (Unonosarara) of Japan. In the Kokka Taikan, Book II, 1901, and on wikipedia.org.

In “Nostalgia,” …these verses…supported me; I’m tossed …dark waters; and Let the storm… as I do mine are from Ovid’s Tristia, Book TI.XI:44, translated by A.S. Kline, 2003. On tkline.freeserve.co.uk.

“Orbiting the Sun (with Photodecomposition of Plastic)”: from the myth of Orpheus in The Metamorphoses of Ovid.

“Code Sequence (A Selfie)” contains a miniscule section of the Homo sapiens forkhead box P2 gene sequence, the so-called “language gene,” and binary code for “I Am That.”

 

 


Janet Kaplan’s full-length poetry books are Ecotones (forthcoming in 2019 from Eyewear Ltd.), Dreamlife of a Philanthropist: Prose Poems & Prose Sonnets, The Glazier’s Country, and The Groundnote. Her honors include grants from the New York Foundation for the Arts and the Bronx Council on the Arts, fellowships and residencies from Yaddo, the Virginia Center for the Creative Arts, the Ucross Foundation in Wyoming, and the Vermont Studio Center. Her work has appeared in Arts & Letters, Barrow Street, Cross Currents, Denver Quarterly, Exposition Review, Interim, Pool, Sentence, The Paris Review, The Southampton Review, Tupelo Quarterly, and many others, as well as in the anthologies An Introduction to the Prose Poem (Firewheel Editions, 2007), Lit from Inside: 40 Years of Poetry from Alice James (Alice James Books, 2012), and Like Light: 25 Years of Poetry & Prose by Bright Hill Poets & Writers (Bright Hill Press, 2017). She has served as poet-in-residence at Fordham University in New York and is currently a member of the creative writing faculty at Hofstra University, where she edits the digital literary magazine AMP. You can find her on Facebook at https://www.facebook.com/janet.kaplan3.

Back to Vol. III: “Orbit”